manuscript rrid addgene 247028 cell genomics 6 (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc manuscript rrid addgene 247028 cell genomics 6
Manuscript Rrid Addgene 247028 Cell Genomics 6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/manuscript+addgene/MMW3759+-+human+expression+plasmid+for+SpCas9+Cluster+4+%2B+Q926A+(Plasmid+%23101190)/pm41887225-518-209-210
Average 90 stars, based on 2 article reviews

manuscript rrid addgene 247028 cell genomics 6 - by Bioz Stars, 2026-10

90/100 stars

Images

Multiple Displacement Amplification:

Article Title: Fibroblast activation protein drives tumor metastasis via a protease-independent role in invadopodia stabilization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat monoclonal anti-FAP (clone D8) Vitatex Cat#MABS1001 Rabbit polyclonal anti-GAPDH GeneTex Cat#GTX100118; RRID:AB_1080976 Rabbit monoclonal anti-MT1-MMP (clone EP1264Y) Abcam Cat#ab51074; RRID:AB_881234 Rabbit polyclonal anti-b-actin GeneTex Cat#GTX109639; RRID:AB_1949572 Mouse monoclonal anti-cortactin (clone 4F11) Millipore Sigma Cat#05-180-I Rat monoclonal anti-FAP (clone D28) Vitatex Cat#MABS1002 Mouse monoclonal anti-Tks5 (clone 13H6.3) Millipore Sigma Cat#MABT336 Rabbit polyclonal anti-Tks5 Santa Cruz Biotechnology Cat#sc-30122; RRID:AB_2254551 Chemicals, Peptides, and Recombinant Proteins Fetal Bovine Serum Sigma-Aldrich Cat#F0926 Insulin Gemini CAt#800-112P human Epidermal Growth Factor (hEGF) Sigma-Aldrich Cat#E9644 Hydrocortisone Sigma-Aldrich Cat#H0888 Gibco HEPES 1M Fisher Scientific Cat#15630080 TransIT-LT1 Transfection reagent Mirus Bio Cat#MIR2306 Protamine Sulfate Salt from salmon Sigma-Aldrich Cat#P4020 Puromycin Dihydrochloride Gemini Cat#400-128P Blasticidin HCl Gemini Cat#400-165P Protease Inhibitor Cocktail Set III-EDTA free Calbiochem Cat#539134 RunBlue LDS Sample Buffer (4X Concentrate) Expedeon Cat#NXB31010 C95 substrate Provided by Dr. Patrick McKee (Edosada et al.)39 N/A M83 inhibitor Provided by Dr. Patrick McKee (Lee et al.)38 N/A GM6001 inhibitor Sigma-Aldrich Cat#364205 Gelatin from pig skin Oregon green 488 conjugated Invitrogen Cat#G13186 Gelatin from porcine skin, Type A Sigma-Aldrich Cat#G2500 VECTASHIELD antifade mounting media with DAPI Vector Laboratories Cat#H-1200 Alexa Fluor 546 Phalloidin Life technologies Cat#A22283 Alexa Fluor 647 phalloidin Life technologies Cat#A22287 Cultrex Reduced Growth Factor Basement Membrane Extract, Type 2 R&D systedm Cat#3533-010-02 Rat tail collagen type I Corning Cat#354236 SPY650-FastAct Cytoskeleton Cat# CY-SC505 Critical Commercial Assays MycoAlert mycoplasma detection kit Lonza Cat#LT07-703 NucleoSpin RNA II kit (Macherey-Nagel) Takara Cat#740984 High-Capacity cDNA Reverse Transcription Applied Biosystems Cat#4368813 iTaq Universal SYBR Green Supermix Biorad Cat#1725124 DC Protein assay Biorad Cat#5000111 ECL Prime western blotting detection reagent Cytiva Cat#RPN2236 Experimental Models: Cell Lines Human: HEK293T cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A Human: HMLE cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A (Continued on next page) 16 Cell Reports 42, 113302, October 31, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: HMLER cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A Human: HMLE-Twist-ER cells Provided by Dr. Robert Weinberg (Mani et al.)28 N/A Human: SUM1315 cells Provided by Dr. Robert Weinberg (Yang et al.)25 N/A Human: MDA-MB-231 cells ATCC CRM-HTB-26 Human: SCC61 cells Provided by Dr. Alissa Weaver (Clark et al.)40 N/A Human: BxPC3 ATCC CRL-1687 Experimental Models: Organisms/Strains Nu/J mice UC San Diego ACP Strain: Nude/nude Oligonucleotides See Table S1 for primers used in this study Eton Bioscience N/A DPP4 shRNA#1: GGTCACCAGTGGGTCATAAAT Sigma-Aldrich TRCN0000372047 DPP4 shRNA#3: GCTGTGAATCCAACTGTAAAG N/A N/A Recombinant DNA pLKO.1 control shRNA Provided by Dr. David Root (Moffat et al.)64 Addgene plasmid #10879 pLKO.1 FAP shRNA #3 Sigma-Aldrich TRCN0000006805 pLKO.1 FAP shRNA #4 Sigma-Aldrich TRCN0000006806 pLKO.1 FAP shRNA #5 Sigma-Aldrich TRCN0000355737 pLKO.1 MT1-MMP shRNA #1 Sigma-Aldrich TRCN0000050853 pLKO.1 MT1-MMP shRNA #3 Sigma-Aldrich TRCN0000050855 pECFP-FAP-C1 plasmid Provided by Dr. Mark Gorrell (Wanget al)56 N/A MT1-MMP-pHluorin plasmid Provided by Dr. Philippe Chavrier (Lizárraga et al.)48 N/A pENTR-20 MT1-MMP-pHuji Provided by Dr. Camilla Raiborg (Pedersen et al.)49 N/A pWZL-Blast FAP S624A this manuscript Addgene Cat207402 pWZL-Blast FAP A657S this manuscript Addgene Cat#207403 LifeAct-EGFP plasmid Provided by Dr. Keith Mostov N/A pRRL EGFP Gift from Dr. Robert Weinberg (Eckert et al.)20 N/A pWZL-Blast SRC Y530F Provided by Dr. Sara Courtneidge7 N/A Software and Algorithms GraphPad Prism 8 GraphPad https://www.graphpad.com/; RRID:SCR_002798 ImageJ NIH https://ImageJ.nih.gov/ij/; RRID:SCR_003070 cBioPortal MSK https://www.cbioportal.org/ NIS-Elements AR Version 5.30.04 Nikon Instruments inc. https://www.nikonusa.com ..

shRNA:

Article Title: High-throughput mapping of modular regulatory domains in human RNA-binding proteins.
Article Snippet: Article High-throughput mapping of modular regulatory domains in human RNA-binding proteins

Recombinant:

Article Title: A methyltransferase-independent role for METTL1 in tRNA aminoacylation and oncogenic transformation.
Article Snippet: Article

Article Title: Optimization of Cas12a for multiplexed genome-scale transcriptional activation
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies APC anti-human CD4 antibody Biolegend Cat#357408; RRID:AB_2565660 FITC anti-human CD26 antibody Biolegend Cat#302704; RRID:AB_314288 APC anti-human CD274 antibody Biolegend Cat#329708; RRID:AB_940360 FITC anti-human CD97 antibody Biolegend Cat#336306; RRID:AB_1227609 Chemicals, peptides, and recombinant proteins Selumetinib Selleckchem Cat#AZD6244 Benzonase (2000 U/mL) Millipore Sigma Cat#E1014 Deposited data Primary Cas12a CRISPRa library fastq files This manuscript SRA: PRJNA958239 Secondary Cas12a CRISPRa validation library fastq files This manuscript GEO: GSE231789 RNAseq fastq files This manuscript GEO: GSE230445 Cas9 CRISPRa library fastq files Sanson et al.33 N/A ORF library read counts This manuscript Data S4 Original code This manuscript GitHub: https://doi.org/10.5281/zenodo.8088225 Experimental models: Cell lines A375 cells Cancer Cell Line Encyclopedia N/A A549 cells Cancer Cell Line Encyclopedia N/A HCC2429 cells Cancer Cell Line Encyclopedia N/A HT29 cells Cancer Cell Line Encyclopedia N/A MelJuSo cells Cancer Cell Line Encyclopedia N/A HEK293T cells ATCC ATCC CRL-3216 Oligonucleotides Library Amplification Forward Primer 1: GTGTAACCCGTAGGGCACCT This manuscript N/A Library Amplification Forward Primer 2: CAGCGCCAATGGGCTTTCGA This manuscript N/A Library Amplification Forward Primer 3: CTACAGGTACCGGTCCTGAG This manuscript N/A Library Amplification Forward Primer 4: CGACGTTATGGATCGACGCC This manuscript N/A Library Amplification Reverse Primer 1: GTCGAAGGACTGCTCTCGAC This manuscript N/A Library Amplification Reverse Primer 2: CGACAGGCTCTTAAGCGGCT This manuscript N/A Library Amplification Reverse Primer 3: CGGATCGTCACGCTAGGTAC This manuscript N/A Library Amplification Reverse Primer 4: AGGTGTCGCGGACTACTCAC This manuscript N/A Recombinant DNA pRDA_763 This manuscript Addgene #201156 pRDA_816 This manuscript Addgene #201157 pRDA_886 This manuscript Addgene #201162 pRDA_887 This manuscript Addgene #201164 (Continued on next page) e1 Cell Genomics 3, 100387, September 13, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pRDA_888 This manuscript Addgene #201165 pLX_317 The Broad Institute https://portals.broadinstitute.org/gpp/ public/vector/details?vector=pLX_TRC317 Software and algorithms PoolQ The Broad Institute https://portals.broadinstitute.org/ gpp/public/software/poolq STAR aligner Dobin et al.47 https://github.com/alexdobin/STAR RNA-Seq by Expectation Maximization Li and Dewey48 http://deweylab.github.io/RSEM/ DESeq2 v1.34.0 Love et al.31 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html CRISPick The Broad Institute https://portals.broadinstitute.org/ gppx/crispick/public enPAM+GB DeWeirdt et al.19 N/A Technology ll OPEN ACCESS

Biomarker Discovery:

RNA sequencing:

Article Title: Optimization of Cas12a for multiplexed genome-scale transcriptional activation
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies APC anti-human CD4 antibody Biolegend Cat#357408; RRID:AB_2565660 FITC anti-human CD26 antibody Biolegend Cat#302704; RRID:AB_314288 APC anti-human CD274 antibody Biolegend Cat#329708; RRID:AB_940360 FITC anti-human CD97 antibody Biolegend Cat#336306; RRID:AB_1227609 Chemicals, peptides, and recombinant proteins Selumetinib Selleckchem Cat#AZD6244 Benzonase (2000 U/mL) Millipore Sigma Cat#E1014 Deposited data Primary Cas12a CRISPRa library fastq files This manuscript SRA: PRJNA958239 Secondary Cas12a CRISPRa validation library fastq files This manuscript GEO: GSE231789 RNAseq fastq files This manuscript GEO: GSE230445 Cas9 CRISPRa library fastq files Sanson et al.33 N/A ORF library read counts This manuscript Data S4 Original code This manuscript GitHub: https://doi.org/10.5281/zenodo.8088225 Experimental models: Cell lines A375 cells Cancer Cell Line Encyclopedia N/A A549 cells Cancer Cell Line Encyclopedia N/A HCC2429 cells Cancer Cell Line Encyclopedia N/A HT29 cells Cancer Cell Line Encyclopedia N/A MelJuSo cells Cancer Cell Line Encyclopedia N/A HEK293T cells ATCC ATCC CRL-3216 Oligonucleotides Library Amplification Forward Primer 1: GTGTAACCCGTAGGGCACCT This manuscript N/A Library Amplification Forward Primer 2: CAGCGCCAATGGGCTTTCGA This manuscript N/A Library Amplification Forward Primer 3: CTACAGGTACCGGTCCTGAG This manuscript N/A Library Amplification Forward Primer 4: CGACGTTATGGATCGACGCC This manuscript N/A Library Amplification Reverse Primer 1: GTCGAAGGACTGCTCTCGAC This manuscript N/A Library Amplification Reverse Primer 2: CGACAGGCTCTTAAGCGGCT This manuscript N/A Library Amplification Reverse Primer 3: CGGATCGTCACGCTAGGTAC This manuscript N/A Library Amplification Reverse Primer 4: AGGTGTCGCGGACTACTCAC This manuscript N/A Recombinant DNA pRDA_763 This manuscript Addgene #201156 pRDA_816 This manuscript Addgene #201157 pRDA_886 This manuscript Addgene #201162 pRDA_887 This manuscript Addgene #201164 (Continued on next page) e1 Cell Genomics 3, 100387, September 13, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pRDA_888 This manuscript Addgene #201165 pLX_317 The Broad Institute https://portals.broadinstitute.org/gpp/ public/vector/details?vector=pLX_TRC317 Software and algorithms PoolQ The Broad Institute https://portals.broadinstitute.org/ gpp/public/software/poolq STAR aligner Dobin et al.47 https://github.com/alexdobin/STAR RNA-Seq by Expectation Maximization Li and Dewey48 http://deweylab.github.io/RSEM/ DESeq2 v1.34.0 Love et al.31 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html CRISPick The Broad Institute https://portals.broadinstitute.org/ gppx/crispick/public enPAM+GB DeWeirdt et al.19 N/A Technology ll OPEN ACCESS .. Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, John Doench (jdoench@broadinstitute.org).

Software:

Article Title: High-throughput discovery and characterization of viral transcriptional effectors in human cells.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies DYKDDDDK Epitope Tag Alexa Fluor 647-conjugated Antibody R&D Systems IC8529R Bacterial and virus strains Endura Electrocompetent Cells Lucigen 60242-2 Chemicals, peptides, and recombinant proteins Doxycycline hyclate Tocris 4090 Celastrol Tocris 3203 SGC-CBP30 Selleck Chemicals S7256 Tazemetostat Selleck Chemicals S7128 TMP269 Selleck Chemicals S7324 Human Interferon beta PeproTech 300-02BC Critical commercial assays Dynabeads M-280 Protein G Thermo Fisher 10003D NEBNext Ultra II RNA Library Prep Kit New England Biolabs E7770S NEBNext Poly(A) mRNA Magnetic Isolation Module New England Biolabs E7490 Deposited data Raw HT-Recruit sequencing files This manuscript BioProject: PRJNA930640 Raw and analyzed RNA-seq data This manuscript BioProject: PRJNA930640; GEO: GSE224325 Human reference genome NCBI build 38, GRCh38 Genome Reference Consortium http://www.ncbi.nlm.nih.gov/projects/ genome/assembly/grc/human/ EBV type 1 B95-8 strain reference sequence NCBI RefSeq: NC_007605.1 EBV type 2 AG876 strain reference sequence GenBank Genbank: DQ279927.1 Experimental models: Cell lines Human: HEK293T Lenti-X Takara 632180 Human: K562 ATCC CCL-243 Human: K562 with pJT039 pEF reporter Tycko et al.8 N/A Human: K562 with pDY32minCMV reporter Tycko et al.8 N/A Human: Cas9+ iSLK-BAC16-K8.1pr-mIFP2 Morgens et al.58 N/A Oligonucleotides vTR and CoV tiling libraries Twist; see Table S1 N/A Spike DMS library Twist; see Table S1 N/A HHV tiling library Twist; see Table S2 N/A HHV perturbation library Twist; see Table S3 N/A HHV hits library Twist; see Table S3 N/A HT-Recruit NGS library prep primers Tycko et al.8 N/A Recombinant DNA pJT039 AAVS1-PuroR-9xTetO-pEFIGKleader-hIgG1_FC-Myc-PDGFRbT2A-Citrine-PolyA Tycko et al.8 Addgene #161927 pDY32 AAVS1-PuroR-9xTetO-minCMVIGKleader-hIgG1_FC-Myc-PDGFRbT2A-Citrine-PolyA Tycko et al.8 Addgene #161928 (Continued on next page) Cell Systems 14, 482–500.e1–e8, June 21, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER pJT126 lenti pEF-rTetR(SE-G72P)3XFLAG-LibCloneSite-T2A-mCherryBSD-WPRE Tycko et al.8 Addgene #161926 pCL040 lenti TRE-3xFLAG-LibCloneSite pEF-rTetR(SE-G72P)-VP48-T2A-mCherryBSD-WPRE This manuscript Addgene #198054 pMD2.G Didier Trono Addgene #12259 pRSV-Rev Didier Trono Addgene #12253 pMDLg/pRRE Didier Trono Addgene #12251 Software and algorithms HT-Recruit analysis pipeline Tycko et al.8 GitHub: https://github.com/bintulab/HT- recruit-Analyze Cytoflow Teague66 GitHub: https://cytoflow.github.io/ DESeq2 Love et al.52 Bioconductor: https://doi.org/10.18129/ B9.bioc.DESeq2 Custom analyses This manuscript GitHub: https://github.com/bintulab/ Viral_Ludwig_2022 (version of record deposited at Zenodo: https://doi.org/10. ..

Review

manuscript rrid addgene 247028 cell genomics 6 (Addgene inc)

Structured Review

Images

Related Articles

Multiple Displacement Amplification:

shRNA:

Recombinant:

Biomarker Discovery:

RNA sequencing:

Software:

Polymerase Chain Reaction:

Plasmid Preparation:

Clone Assay:

Gel Purification:

Ligation:

Real-time Polymerase Chain Reaction:

Quantitative RT-PCR:

Knockdown:

RNA Sequencing:

Similar Products

Image Search Results